ULS2201
THE BIOMOLECULAR REVOLUTION (2014/2015, Semester 1) 

 MODULE OUTLINE Created: 21-Jun-2014, Updated: 21-Jun-2014
 
Module Code ULS2201
Module Title THE BIOMOLECULAR REVOLUTION
Semester Semester 1, 2014/2015
Modular Credits 4
Faculty University Scholars Programme
Department University Scholars Programme
Timetable Timetable/Teaching Staff
Module Facilitators
ASSOC PROF Uttamchandani Mahesh Lecturer
Weblinks
Tags --


Learning Outcomes | Prerequisites | Teaching Modes | Schedule | Synopsis | Syllabus | Practical Work | Reading List - Homework | Assessment | Grading | Preclusions | Workload | References


 LEARNING OUTCOMES Top
This module aims to give an overview of a living cell, genetic basis of diseases, biological molecules and their applications in undertaking clinical challenges. In brief, the student will learn the basic concepts of molecular biology, genetics, genetic engineering and biotechnology relevant to the biomolecular revolution. New frontiers of the revolution will be discussed with the emphasis of their impacts on the individual and society. Through contemporary readings, students will be provoked to think of issues arising from the biomolecular revolution.


 PREREQUISITES Top
This module is open to only USP Students


 TEACHING MODES Top
At the end of this module, the student will have very strong theoretical and practical knowledge on
  • Molecular biology and genetics: DNA, genes, proteins, gene expression and genetics
  • DNA technologies: Genetic engineering and recombinant DNA techniques
  • Hot topics of biomedicine: Functional genomics, DNA microarrays, molecular diagnostics, pharmacogenetics, gene therapy, stem cells and human therapeutic cloning.
  • Bioethics
The practical classes cover DNA agarose gel electrophoresis, PCR and DNA fingerprinting. The tutorials will cover cloning a gene in a vector and protein expression and purification. There is a visit to biomedical research laboratories. Students will interview local biomedical scientists, prepare a short newspaper article, debate ideas and discover about how biomedical products bridge commercialization challenges to reach consumers.


 SCHEDULE Top
Time-table  2014-15 Semester-1

Tue: 4pm - 6 pm, Venue - SRI, Cinnamon College
Thu: 4pm - 6 pm, Venue - SR1, Cinnamon College OR Lab-3 (S1A, Level-4) at the Biological Science Dept, Faculty of Science (see Timetable for practical sessions)

No Exam


 SYNOPSIS Top
Molecules are the machines of life. Biomolecules include DNA, RNA and proteins. Back in the 1980's, life science disciplines that studied these biomolecules were restricted to select research laboratories. Today, the names of the biomolecules and events surrounding their development and use has become common public knowledge, with the latest developments routinely covered in daily newspapers. The impact from the biomolecular revolution is regarded as one of the greatest technological revolutions in world history that will likely span many more decades to come. We are in a golden age for biology, and never has the pace of research and development in the biomedical sciences been so intense, in all of human history. The biomolecular revolution will ultimately provide human beings the capability of manipulating life at its most fundamental levels, from producing bioengineered tissues/organs to controlling life itself.

How did the biomolecular revolution start? What is the key technology drivers behind the revolution? What could be the impact of the revolution to our lives? This module is designed to provide a forum for discussing these issues and an opportunity for students to gain insights into the principles of genetic manipulation/cloning/stem cells/synthetic biology and to recognize their applications, mainly in biomedicine. Particularly, the module aims to help students develop a fact-based understanding of potential benefits and risks associated with the biomolecular revolution and increase the awareness of the ethical, legal and social issues that may arise, to prepare ourselves for a changing future.

FAQs

Who should take ULS2201?

Principles in biology will be taught from the ground up, so those of you who may not have any background in biology need not worry about not being able to cope. For biology/life science majors, this is a course you should consider as well, as it will bring across biology through very different perspectives (from what you are used to in your normal LS curriculum). Note that this is not a course to teach biology to biologists. So no matter what your background, I am sure this course will excite and stimulate you all as USP students.

Is it really easier because there is no exam? Not really...
There is no exam, so you are graded entirely through continual assessments. I have spread your assignments throughout the semester,  and you are provided all the assignment questions and deadlines upfront. The key is really for you to plan your time well and balance this against the workload from your other modules. (So I hope this reduces the pressure somewhat!) 

I wish you a fulfilling learning journey! Feel free to contact me should you have any qns. :)   

 



 SYLLABUS Top
Version 05, dtd Oct 10, 2014

Time-table 2014-15 Semester-1
ULS2201 The Biomolecular Revolution
Tuesday: 4 pm - 6pm@ SR1 (U Town)
Thursday: 4pm - 6pm SR1 (U Town) or LS-Lab 3 (S1A, Level-4)
 
Week Date Activity Topic Lecturer Note   
                                                Aug 4-9, 2014 No class
1 Aug 12 L1 Revolutions in Biology Mahesh  
Aug 14 L2 The Cell as a Machine Mahesh  
2 Aug 19 L3 DNA Bits and Bytes Mahesh  
Aug 21 L4 The Human Genome and Identity Mahesh  
3 Aug 26 P1 DNA miniprep, Restriction enzyme digestion, setting up PCR Mahesh Lab
Aug 28 L5 Genetics and Disease Mahesh  
4 Sep 2 Guest Lecture Science and the Media Shi'an (MTI)  
Sep 4 L6 Protein Machines Mahesh  
5 Sep 9 P2 Seeing DNA (gel electrophoresis) Mahesh Lab
Sep 11 T1 Cloning/Protein expression/Quiz Mahesh  
6 Sep 16 L7 Food Security and Climate Change Mahesh  
Sep 18 P3 Visit to DSO Nat’l Labs Mahesh DSO
Sep 20-28, 2014 Mid-semester break, No class
7 Sep 30 P4 Is your food genetically modified? Mahesh Lab
Oct 2 L8 Biofuels Mahesh  
8 Oct 7 L9 Biomarkers and Proteomics Pamela  
Oct 9 L10 Stem Cells - Class Debate Mahesh  
9 Oct 14 P5 Is your food genetically modified? Mahesh Lab
Oct 16 L11 Germ Warfare and Biosecurity Mahesh  
10 Oct 21 L12 Genetic Engineering and Synthetic biology Mahesh  
Oct 23 No class
11 Oct 28 L13 Bioethics Pamela
 
 
Oct 30 No Class Free slot for presentation planning    
12 Nov 4 S1 Presentation Mahesh  
Nov 6 S2 Presentation Mahesh  
13 Nov 11 S3 Presentation Mahesh  
Nov 13 No class
             
 





































No Exam
 
L-Lecture        P-Practical       T-Tutorial        S-Seminar
 
Module Co-ordinator:          Asst Prof. Mahesh Uttamchandani (mahesh@nus.edu.sg)
 
Lecturers:                              Asst Prof. Mahesh Uttamchandani (mahesh@nus.edu.sg)
                                                Guest Lecturers: Dr Pamela Pun (DSO)
                                                                            Ms Tay Shi’an (MTI)
 
Mode of Assessment:
 
Short article assignments                             40
-Response paper (10)
-Lab report (15)
- Interview/Newspaper article (15)
Quiz                                                                   10
Presentation                                                    20
Term paper                                                      30
 


 PRACTICAL WORK Top
ULS2201 The Biomolecular Revolution
Practical 1/2
August 26, Sep 9 (Tue, 4pm-6pm, LSM Lab-3, S1A, Level 4)
 
Brief Instructions
 
AIMS
 

  1. View bacteria under microscope, reverse-drop method
  2. Purify plasmid DNA from bacterial culture                                             
  3. Set-up a PCR reaction
  4. Run a 1% agarose gel electrophoresis to visualize DNA                      
 
!  POINTS ON SAFETY:
 

  1. Wear covered shoes for all practicals.
  2. Ladies to tie up long hair.
  3. Lab-coats to be worn in the lab (will be provided, sign out at the lab).
  4. Gloves will be provided – use when handling DNA, live bacterial cultures, agarose gels.
(do not touch your face and body with the gloves, they are meant to protect you)
 
REQUIRED ITEMS
 

  1.  Bacterial culture (grown overnight at 37oC), light microscope, cover-slips/glass slides
  2. DNA extraction kit
  3. PCR kit, including PCR buffer, MgCl2, dNTP, primers, plasmid template and Taq polymerase
  4. Agarose, TAE buffer, DNA loading dye, marker, gel casting tray, electrophoresis apparatus, power supply
 
DESCRIPTION
 
Observing bacteria under the microscope: The microscope is one of the most important tools for biologists. Through the power of observation and using tools like the microscope, biologists have through the centuries learnt a lot about nature.
In this practical, you will be able to see what bacteria cells (Escherichia coli) look like. E. coli is one of the most common bacteria found in your gut. Questions you should think about include: How are the cells shaped and organized, how do they behave, how do they sense their environment?
 
Use of Pipettes (and disposable tips) : If you have never used pipettes before, today is your chance to get to know how.They are the tools biologists use to measure and transfer small volumes of liquid. Pipettes are thus, in essence, just measuring cylinders for micro-litre (ml) volumes of liquid.  
 
DNA Isolation: A plasmid (also known as vector) is a circular, double stranded piece of DNA, which has the ability to replicate in bacterial hosts. The bacterial culture on your bench is an E. coli strain (Top10) that has been modified for lab use and is thus safe and non-infections. (You should still be cautious and wear gloves and lab-coat when you handle any live microbes in the laboratory). These bacteria cells have beentransformed with a plasmid of interest, which contains the DNA sequence to express a particular protein of interest. An overnight culture grows a population of bacterial cells with many copies of the plasmid of interest, producing abundant stocks of plasmid for further manipulation and analysis, for example by PCR.
 
Transformation – The uptake of foreign DNA into bacterial cells.  
Protein expression – Getting microbes to produce (like a factory) a protein of interest.
Polymerase Chain Reaction (PCR): PCR is a powerful DNA analytical tool, because of its ability to amplify target regions of choice. It represents a “photocopying machine” for DNA, which allows segments of DNA to be amplified and detected. We cannot “see” or “sense” the presence of single copies of DNA that may be present in a sample. With the advent PCR in the 1980s, DNA molecules can be amplified more than a million times in a single reaction, allowing a more abundant population of molecules for detection and analysis. This molecular method can tell you whether you have been infected with a particular bacteria, virus or parasite much more sensitively than traditional microscopy, or other protein-based diagnostic methods. 
 
READING ASSIGNMENT ON PCR: (use online sources/textbooks, as you prefer)
The features that you should learn about include the special properties of Taq polymerase (where it comes from, how does it work?), as well as the Forward and Reverse primers, which are short single stranded oligonucleotides that “prime” the polymerase and determine the target region that is amplified. Through this exercise, you should be able to figure out why the PCR reaction exponential.
 
PCR Set-up:
 

Reagents Positive Reaction
(μl – micro-litre)
 
Negative control (why is this necessary?)
10×PCR buffer (contains salts to maintain the pH of the reaction, and keep the enzyme happy) 2 μl 2 μl
Plasmid template
(the purified plasmid)
1 μl 0 μl
Forward Primer
5’- CACCAAAGATACTGTCTACGTCAC
2 μl 2 μl
Reward Primer
5’- GGGCTATTATTTGATCGTTGTTTTC
2 μl 2 μl
2mM dNTP mix (comprising dATP, dTTP, dCTP and dGTP)
d– deoxy, N- nucleotide
2 μl 2 μl
Taq 0.5 μl 0.5 μl
ddH2O for a final reaction volume of 20 μl 10.5 μl 11.5 μl
 
Thermocycling conditions:
 

Segment Number of cycles Temperature Duration
1 1 95°C 2 minutes
2 30 95°C 30 seconds
50°C 45 seconds
72°C 2 minute
3 1 72°C 10 minutes
 
 
Gel electrophoresis: Agarose is a polymer made from carbohydrates. An agarose gel is able to separate DNA molecules based on size. The smaller the molecules of DNA, the faster they would pass through the pores within the agarose gel when a current is applied (electrophoresis), and hence will displace a further distance away from the wells. Use four lanes to load (1) DNA ladder (as a pre-determined marker of known sizes of DNA samples, to gauge the sizes of unknown DNA segments) (2) Plasmid DNA, (3) PCR product, (4) PCR negative control.

ULS2201: The Biomolecular Revolution
Practical 3 (18 Sep) 
Visit to DSO National Laboratories.
Meet at DSO Bldg (near the Science canteen) - meeting room to be confirmed.

ULS2201: The Biomolecular Revolution
Practical 4/5 (30th Sep and 14th Oct)
Outline
DNA analysis can be used as a tool to reveal the genetic make-up and contents of any biological specimen. Such analysis can be applied to show relatedness or identity of individual humans, plants or animals. DNA typing has become the subject of much debate and interest because of its uses for forensic analysis in prominent criminal cases, such as the O. J. Simpson case. The applications of DNA typing, however, are much broader than forensic science alone and have a profound impact on our society.

Your job as a AVA Food Investigator is to establish whether a sample of food has been genetically modified:
 
(You and your partner can decide on whatever sample of food to choose, some examples of what you could pick include: ________ (list to be provided)
Tube 1 contains DNA from an actual genetically modified sample
Tube 2 contains DNA from a non-genetically modified sample
Tube 3 contains DNA from your test sample
 
You are provided with a mortar and pestle to grind your sample, extraction buffers to isolate DNA, several sets of PCR primers, Taq polymerase, dNTPs and PCR buffers along with loading dye and agarose gel apparatus.
With these resources, establish whether the sample you have chosen is genetically modified. Discuss how confident you are with your results and how ‘strong’ or ‘weak’ this evidence is. Write a report of your analysis and findings in the following format:
Aims:
Introduction:
Experimental Methods:
Results:
Discussion:
Conclusion:
References:
Appendix:
 
(Keep within 8 pages, double-spaced, times new roman, font 12, exclusive of a 2-3 page appendix containing the graphs/figures/gel images). Work in your pairs to submit your reports to Dr Mahesh through IVLE workbin, by 5pm on the 24th of Oct. You will be assessed on the scientific rigour, quality of the results and quality of the overall report.   

 



 READING LIST - HOMEWORK Top
Week 1

Watch this video: Inside the Living Body
(time needed: 1.5h) 

Learning objectives: If you have not read biology before, please watch this video. It provides an excellent overview of human biology and anatomy. It covers essential concepts about the 6 senses. Yes, there are 6. Can you name them? It also describes the journey of how our bodies develop. You will learn about how food is digested, how you form memories and how the immune system protects you against infections.

How much do you know about your body? Think about why you are the way you are, could you have been any different?  

If there is anything you did not fully understand - please raise it in class.

Week 2 (time needed: 20min, or 3h optional)
View the trailers of these interesting Sci-Fi movies. You may have already watched these movies. I think the Gattaca DVD is available in the USP movie library, not sure about The Island though.

a) Gattaca (1997)

b) The Island (2005)

Learning objectives: How real are these scenarios? Are we past the point of no return, and will scientific progress inevitably lead to such dystopian futures?

Week 3 (Depending on how much you know, this assignment may take you anywhere between 5 min and 3h) 

Kary Mullis invented the polymerase chain reaction (PCR) in 1983, and won a Nobel prize in Chemistry for his achievement in 1993.

a) What was his eureka moment?
b) Why is PCR exponential, not linear?

Learning objectives: You will be performing PCR in the laboratory. It is a method of amplifying DNA. Just like the printing press made books and newspapers available to the masses, PCR made the manipulation and re-organization of DNA possible, at an unprecedented scale. What has mankind been able to accomplish with PCR?  




 ASSESSMENT Top

Assessment Plan                                % of Total Grade
1) In-class discussion/ Attendance       0   (+1/+2 % given for very sensible comments/ideas contributed in class, and -3/-5% if absent during random attendance taking)
2) Short article assignment                   40
- 1 Lab report (15 marks)                                              (groups of 2)
- 1 response paper (1x 10 marks)                                 (individual)
- Interview/Newspaper article (15 marks)                  (group of 2 interview, individual article)
3) Presentation                                     20                    (groups of 2)
4) Quiz                                                    10                    (individual)
5) Term paper                                       30                    (individual)
                                                Total: 100%
ULS2201
Response Paper (10%)
Limit: 500 words - about two pages, Times New Roman, Font 12, double-spaced.
Deadline: Week 3, 29 Aug, 5pm. – Submit to IVLE workbin  
Choose between:
 

  1. Describe what you think has been the greatest discovery or breakthrough in biology over the last 100 years?
  2. Recommend a discovery or breakthrough that you think deserves the 2014 Nobel Prize in Physiology or Medicine.

Quiz (10%)
Week 5, 11th Sep.
 

  1. Quiz on P1, P2 and L1-L6

Short answer, True/False, MCQ type questions.

Lab Report (10%)
Deadline: Week 10, 24th Oct, 5pm. – Submit to IVLE workbin  
 

  1. Working in pairs, write a scientific report on experiments performed to identify a whether a food sample was genetically modified.

 
Interview/Newspaper Article (15%)
Deadline: Week 8, 10th Oct, 5pm. – Submit to IVLE workbin  
 

  1. In pairs, identify and interview a scientist based locally (working in the life sciences). Make an appointment for a 20 min interview. Come prepared to the interview, and identify the questions/areas you want to probe for your story. As far as possible, do not contact your interviewee beyond the interview (as they are busy people), and are already being very kind by granting you an interview. Start planning for this early, if you tell me at week 7/8 that you have not been able to identify a subject, I would be hard-pressed to help you. A good source of background material is their journal publications, which you can access through the NUS digital libraries (eg. through searches on PUBMED or Web of Science. Information may also be available on their profile pages on Researcher ID or ResearchGate)
  2. Once you have identified an interviewee, list him/her on the google e-form/ivle so the same interview subject, should not receive multiple requests from different students. If subject declined, please list it as such, so that this information can be instantly shared with the rest of the students in the class.
  3. Individually, write a newspaper article of between 500-700 words on the work of this scientist. The intent here is to bring awareness of biomedical research being done in Singapore, and at the same time enthuse, stimulate and excite the readership (in this case - the general Singapore public). 

https://docs.google.com/document/d/13O0OQQSr6wbVbqfoWVFTKVNIGuwK4EbgB_dyRGap4ms/edit?hl=en&authkey=CJH1070P 
 
Presentation (20%)
According to schedule, over Weeks 11-13
 

  1. Work in pairs, to select and present a biological technology, which is in use today, and describe how the science successfully bridged “the valley of death”, to reach consumers like you and me. 

https://docs.google.com/document/d/1b4WUewRZrdoLfQS2WQs2i4OO0T8azgo46OKwqoWt534/edit?hl=en&authkey=CNjV5c0E
 

  1. In addition, each pair will be assigned to peer review another group’s presentation. This is to encourage the class to ask smart, informed and incisive questions. The quality of the Q&A will contribute towards your overall presentation grade. 

Term paper (30%)
Deadline: Week 14 (Reading Week), 21st Nov, 5pm. – Submit to IVLE workbin  
 

  1. Describe what life will be like in the year 2070, as a result of revolutions in biology.
  2. Describe what living in Singapore will be like in the year 2070, as a result of revolutions in biology.

Your term paper should be around 10 pages long: Times New Roman, Font size: 12, double spaced. Do not exceed 2500 words.



 GRADING Top
The grading scheme, and the work of past students, is available - here.




 PRECLUSIONS Top
NIL


 WORKLOAD Top
2-2-0-0-6

Workload Components : A-B-C-D-E
A: no. of lecture hours per week
B: no. of tutorial hours per week
C: no. of lab hours per week
D: no. of hours for projects, assignments, fieldwork etc per week
E: no. of hours for preparatory work by a student per week


 
 2. TEXT & READINGS Top
 
Books
Biology (8th Edition) by Neil A. Campbell and Jane B. Reece, 2007, Benjamin Cummings
Molecular Cell Biology (6th Edition) by Lodish et al., 2008, Freeman.
Molecular Biology of the Cell (4th Edition), Alberts et al.,
   2002, Garland.
 
Internet
 
Encyclopedia of Life Sciences, Wiley


Learning Outcomes | Prerequisites | Teaching Modes | Schedule | Synopsis | Syllabus | Practical Work | Reading List - Homework | Assessment | Grading | Preclusions | Workload | References